EF1α-hsaCas9 Two Vector AAV Cas9 SmartNuclease™ Expression Plasmid

Extend genome editing capabilities to cutting edge in vivo applications with our Two Vector AAV Cas9 SmartNuclease Expression Plasmid EF1α-hsaCas9.
  • Deliver Cas9 in vivo
  • Edit genomes in post-natal animals
  • Develop gene therapies in small animal models
  • Generate novel disease models
  • Choose from All-in-one or Two Vector AAV-Cas9 systems

Products

Catalog Number Description Size Price Quantity Add to Cart
CASAAV200PA-1 Cas9 expression vector for the Two Vector AAV SmartNuclease System (EF1α-hsaCas9 AAV Plasmid) 10 µg $643
- +

Overview

Overview

Expanding your genome editing capabilities with our flexible AAV Two Vector System

Bringing together the versatile CRISPR/Cas9 genome editing system with powerful recombinant AAV (rAAV) technology, SBI’s AAV Cas9 SmartNuclease™ vectors extend genome editing capabilities to cutting edge in vivo applications.

EF1α-hsaCas9 Two Vector AAV Cas9 SmartNuclease Expression Plasmid

For situations where you would like to introduce saCas9 and gRNA separately, SBI offers a Two Vector AAV Cas9 SmartNuclease System with saCas9 expressed on one vector using the strong, constitutive EF1α promoter (EF1α-hsaCas9 Two Vector AAV Cas9 SmartNuclease Expression Plasmid, Cat# CASAAV200PA-1) and gRNA expressed on a separate vector using the U6 shRNA promoter (EF1α-RFP-U6-gRNA(SA) AAV Cas9 SmartNuclease gRNA Expression Plasmid, Cat# CASAAV300PA-1).

Please note the “How it Works” section below, which provides instructions for the slightly different gRNA design needed when using hsaCas9.
  • Deliver Cas9 in vivo
  • Edit genomes in post-natal animals
  • Develop gene therapies in small animal models
  • Generate novel disease models
  • Choose from All-in-one or Two Vector AAV-Cas9 systems

Why AAV?

With their broad tropism, the lack of disease associated with wild-type virus, ability to transduce both dividing and non-dividing cells, and long term transgene expression, recombinant AAV (rAAV) has recently become the method of choice for delivering gene therapy and genome engineering vectors to intact organisms1, 2. However, for efficient packaging, inserts into the region between rAAV’s two ITR sequences must be less than 5 kb.

Why saCas9?

The development of CRISPR/Cas9 has already revolutionized what’s possible when it comes to manipulating the genomes of even complex organisms. However, in vivo delivery via rAAV vectors has been hampered by the size of the Streptococcus pyogenes Cas9 gene (spCas9), the most widely-used form of Cas9. To overcome this problem, Ran, et al,1 characterized smaller orthologs of the Cas9 gene and found that Cas9 from Staphylococcus aureus (saCas9) performs as efficiently as spCas9 while being ~1 kb shorter, enabling insertion into rAAV vectors.

Why SBI for AAV-Cas9?

With advanced rAAV systems and a range of easy-to-use Cas9 vectors and kits, SBI has the expertise to combine these two technologies into a single, easy-to-use, and powerful system. Choose from our All-in-one or Two Vector systems to drive your in vivo genome editing studies into high gear.

Why an HR targeting vector is a recommended

Even though gene knock-outs can result from DSBs caused by Cas9 alone, SBI recommends the use of HR targeting vectors (also called HR donor vectors) for more efficient and precise mutation. HR donors can supply elements for positive or negative selection ensuring easier identification of successful mutation events. In addition, HR donors can include up to 6-8 kb of open reading frame for gene knock-ins or tagging, and, when small mutations are included in either 5’ or 3’ homology arms, can make specific, targeted gene edits.

Not sure whether you need a CRISPR/Cas9 plasmid, purified protein, or mRNA?

Use this table to choose the CRISPR/Cas9 product that’s right for you:

For This Application
In these types of cells
Use These Products
MODIFYING ORGANISMS

  • Gene tagging

  • Transgenic organism generation

  • Model organism engineering

Embryos—to create transgenic animalsInjectable Cas9 mRNA & gRNA Synthesis Kits
Cas9 Protein
EGFP-labeled Cas9 Protein
Animals models—in vivo genome editingAAV-Cas9 Vectors  
Cas9 Protein
EGFP-labeled Cas9 Protein
MODIFYING CELL LINES

  • Stable KO, KI, and genome editing of
    somatic cells

  • Transgenic cell line generation

  • Cell-based disease models

Cells that are transfectableCas9 Plasmids
Cas9 Protein
EGFP-labeled Cas9 Protein
Difficult-to-transfect cell lines:

  • Primary cells

  • Hematopoietic cells

  • Stem cells

AAV-Cas9 Vectors 
Lenti Cas9 Systems
SCREENING

  • Genome-wide surveys

  • gRNA library screens

  • Functional screens

All cell types requiring stable Cas9 overexpressionLenti Cas9 Systems
AAVS1 Safe Harbor Site Cas9
Gene Knock-in System
Cas9 Protein
EGFP-labeled Cas9 Protein
PRE-CLINICAL APPLICATIONS
  • Off-target events are of highest concern
All cell types and applicationsCas9 Nickase, available in all delivery formats
Cas9 Protein
EGFP-labeled Cas9 Protein
SIMULTANEOUS ENGINEERING OF MULTIPLE MUTATIONSAll cell types and applicationsMultiplex gRNA cloning kit, compatible with all Cas9 delivery options
References
  1. Vasileva A and Jessberger R. Precise hit: adeno-associated virus in gene targeting. Nat Rev Microbiol. 2005 Nov; 3(11):837-47. PMID: 16261169.
  2. Petrs-Silva H and Linden R. Advances in gene therapy technologies to treat retinitis pigmentosa. Clin Ophthalmol. 2014; 8:127–136. PMCID: PMC3878960.
  3. Ran, F. A. et al. In vivo genome editing using Staphylococcus aureus Nature. 2015; 520:186–191. PMCID: PMC4393360.
 

How It Works

How It Works

Using saCas9

While saCas9 is just as efficient as spCas9, a few differences between the two systems will affect gRNA design1.

  • saCas9 PAM differs from spCas9 PAM
  • saCas9 works most efficiently with gRNAs of 21 nt – 23 nt

Contact us with any questions on gRNA design for saCas9 or about using our AAV-Cas9 vectors by emailing tech@systembio.com.
saCas9 PAM sequences:
NNGGGT
NNGAAT
NNGAGT

To create gRNAs for AAV Cas9 SmartNuclease Plasmids, use the following:

Fwd-5.1: ACCGNNNNNNNNNNNNNNNNNNNNN (N target sequence or gRNA sequence, 21 nts)
Rev-3.1: aaacXXXXXXXXXXXXXXXXXXXXX (X reverse complementary of N, 21 nts)

Example:

aavs1 gRNA for saCas9: CTGTCCCTAGTGGCCCCACTG

sa-AAVS1gRNA-5.1 ACCGCTGTCCCTAGTGGCCCCACTG
sa-AAVS1gRNA-3.1 aaacCAGTGGGGCCACTAGGGACAG

The workflow at-a-glance  

  1. Design two DNA oligonucleotides that are sense and antisense sequences of the target DNA and are immediately upstream of a PAM sequence (see above section on creating gRNAs for AAV Cas9 SmartNuclease Plasmids)
  2. Anneal the two oligonucleotides to generate a duplex
  3. Ligate the duplex into the pre-linearized All-in-one AAV Cas9 SmartNuclease Plasmid
  4. Transform into competent cells and grow in LB/Kanamycin plate (50 µg/ml)
  5. Confirm positive clones by direct sequencing
  6. Transfect sequence-verified All-in-one construct into AAV packaging cells
  7. Isolate packaged All-in-one AAV Cas9 SmartNuclease Plasmid using AAVanced AAV Concentration Reagent for easy, high-titer preparations

Your AAV Cas9/gRNA virus is ready for your genome editing project.

Genome engineering with CRISPR/Cas9

For general guidance on using CRISPR/Cas9 technology for genome engineering, take a look at our CRISPR/Cas9 tutorials as well as the following application notes:

CRISPR/Cas9 Gene Knock-Out Application Note (PDF) »
CRISPR/Cas9 Gene Editing Application Note (PDF) »
CRISPR/Cas9 Gene Tagging Application Note (PDF) »

CRISPR/Cas9 Basics

Through careful selection of the target sequence and design of a donor plasmid for homologous recombination, you can achieve efficient and highly targeted genomic modification with CRISPR/Cas9.

The system

A quick overview of the CRISPR/Cas9 System.

Cas9 protein—uses guide RNA (gRNA) to direct site-specific, double-strand DNA cleavage adjacent to a protospacer adapter motif (PAM) in the target DNA.

gRNA—RNA sequence that guides Cas9 to cleave a homologous region in the target genome. Efficient cleavage only where the gRNA homology is adjacent to a PAM.

PAM—protospacer adapter motif, NGG, is a target DNA sequence that spCas9 will cut upstream from if directed to by the gRNA.

The workflow at-a-glance

DESIGN: Select gRNA and HR donor plasmids. Choice of gRNA site and design of donor plasmid determines whether the homologous recombination event results in a knock-out, knock-in, edit, or tagging.

CONSTRUCT: Clone gRNA into all-in-one Cas9 vector. Clone 5’ and 3’ homology arms into HR donor plasmid. If creating a knock-in, clone desired gene into HR donor.

CO-TRANSFECT or CO-INJECT: Introduce Cas9, gRNA, and HR Donors into the target cells using co-transfection for plasmids, co-transduction for lentivirus, or co-injection for mRNAs.

SELECT/SCREEN: Select or screen for mutants and verify.

VALIDATE: Genotype or sequence putative mutants to verify single or biallelic conversion.

Supporting Data

Supporting Data

Genome engineering with SBI’s All-in-one AAV Cas9 SmartNuclease Plasmids

Both SBI’s all-in-one AAV-Cas9 and two-vector AAV-Cas9 systems efficiently correct a dysfunctional genomic copy of EGFP.

Starting with an Enhanced Green Fluorescent Inhibited Protein (EGIP) reporter cell line, which has an inactivated EGFP due to a premature stop codon, we designed a gRNA sequence and HR rescue donor to remove the stop codon and enable GFP expression. The gRNA sequence was inserted into either Cat # CASAAV300PA-1, EF1-RFP-U6-gRNA(SA)—the gRNA-expressing plasmid in the Two Vector AAV Cas9 SmartNuclease System (Figure 1, top panels)—or Cat # CASAAV100PA-1, the EF1α-hsaCas9-U6-gRNA(SA) All-in-one AAV Cas9 SmartNuclease Plasmid (Figure 1, bottom panels).

AAV virus particles isolated from both cell lysates (Figure 1, left panels) and packaging supernatants (Figure 1, right panels) were delivered to cells with the rescue HR donor and restored EGFP expression, indicating successful genome editing.

Delivery of AAV plasmid(s) alone (Figure 1, middle panels) with HR donor also restored EGFP expression, again indicating successful genome editing.

Both SBI’s all-in-one AAV-Cas9 and two-vector AAV-Cas9 systems efficiently correct a dysfunctional genomic copy of EGFP

Figure 1. Both SBI’s all-in-one AAV-Cas9 and two-vector AAV-Cas9 systems efficiently correct a dysfunctional genomic copy of EGFP. METHODS: Approximately 1 – 1.5 x 106 EGIP reporter cells were seeded into a 12-well plate for infection with isolated AAV particles (left and right panels) or transfection with plasmid (middle panels), along with the HR rescue donor. The top panels were treated with the Two Vector AAV Cas9 SmartNuclease System plus HR rescue donor designed to correct the defect in EGIP, restoring EGFP expression. The bottom panels were treated with the All-in-one AAV Cas9 SmartNuclease Plasmid plus the same HR rescue donor. Three days post-infection or transfection, EGFP-positive cells can clearly be seen, indicating successful genome editing.

FAQs

Resources

Citations

EF1α-hsaCas9 Two Vector AAV Cas9 SmartNuclease™ Expression Plasmid $643.00

Products

Catalog Number Description Size Price Quantity Add to Cart
CASAAV200PA-1 Cas9 expression vector for the Two Vector AAV SmartNuclease System (EF1α-hsaCas9 AAV Plasmid) 10 µg $643
- +

Overview

Overview

Expanding your genome editing capabilities with our flexible AAV Two Vector System

Bringing together the versatile CRISPR/Cas9 genome editing system with powerful recombinant AAV (rAAV) technology, SBI’s AAV Cas9 SmartNuclease™ vectors extend genome editing capabilities to cutting edge in vivo applications.

EF1α-hsaCas9 Two Vector AAV Cas9 SmartNuclease Expression Plasmid

For situations where you would like to introduce saCas9 and gRNA separately, SBI offers a Two Vector AAV Cas9 SmartNuclease System with saCas9 expressed on one vector using the strong, constitutive EF1α promoter (EF1α-hsaCas9 Two Vector AAV Cas9 SmartNuclease Expression Plasmid, Cat# CASAAV200PA-1) and gRNA expressed on a separate vector using the U6 shRNA promoter (EF1α-RFP-U6-gRNA(SA) AAV Cas9 SmartNuclease gRNA Expression Plasmid, Cat# CASAAV300PA-1).

Please note the “How it Works” section below, which provides instructions for the slightly different gRNA design needed when using hsaCas9.
  • Deliver Cas9 in vivo
  • Edit genomes in post-natal animals
  • Develop gene therapies in small animal models
  • Generate novel disease models
  • Choose from All-in-one or Two Vector AAV-Cas9 systems

Why AAV?

With their broad tropism, the lack of disease associated with wild-type virus, ability to transduce both dividing and non-dividing cells, and long term transgene expression, recombinant AAV (rAAV) has recently become the method of choice for delivering gene therapy and genome engineering vectors to intact organisms1, 2. However, for efficient packaging, inserts into the region between rAAV’s two ITR sequences must be less than 5 kb.

Why saCas9?

The development of CRISPR/Cas9 has already revolutionized what’s possible when it comes to manipulating the genomes of even complex organisms. However, in vivo delivery via rAAV vectors has been hampered by the size of the Streptococcus pyogenes Cas9 gene (spCas9), the most widely-used form of Cas9. To overcome this problem, Ran, et al,1 characterized smaller orthologs of the Cas9 gene and found that Cas9 from Staphylococcus aureus (saCas9) performs as efficiently as spCas9 while being ~1 kb shorter, enabling insertion into rAAV vectors.

Why SBI for AAV-Cas9?

With advanced rAAV systems and a range of easy-to-use Cas9 vectors and kits, SBI has the expertise to combine these two technologies into a single, easy-to-use, and powerful system. Choose from our All-in-one or Two Vector systems to drive your in vivo genome editing studies into high gear.

Why an HR targeting vector is a recommended

Even though gene knock-outs can result from DSBs caused by Cas9 alone, SBI recommends the use of HR targeting vectors (also called HR donor vectors) for more efficient and precise mutation. HR donors can supply elements for positive or negative selection ensuring easier identification of successful mutation events. In addition, HR donors can include up to 6-8 kb of open reading frame for gene knock-ins or tagging, and, when small mutations are included in either 5’ or 3’ homology arms, can make specific, targeted gene edits.

Not sure whether you need a CRISPR/Cas9 plasmid, purified protein, or mRNA?

Use this table to choose the CRISPR/Cas9 product that’s right for you:

For This Application
In these types of cells
Use These Products
MODIFYING ORGANISMS

  • Gene tagging

  • Transgenic organism generation

  • Model organism engineering

Embryos—to create transgenic animalsInjectable Cas9 mRNA & gRNA Synthesis Kits
Cas9 Protein
EGFP-labeled Cas9 Protein
Animals models—in vivo genome editingAAV-Cas9 Vectors  
Cas9 Protein
EGFP-labeled Cas9 Protein
MODIFYING CELL LINES

  • Stable KO, KI, and genome editing of
    somatic cells

  • Transgenic cell line generation

  • Cell-based disease models

Cells that are transfectableCas9 Plasmids
Cas9 Protein
EGFP-labeled Cas9 Protein
Difficult-to-transfect cell lines:

  • Primary cells

  • Hematopoietic cells

  • Stem cells

AAV-Cas9 Vectors 
Lenti Cas9 Systems
SCREENING

  • Genome-wide surveys

  • gRNA library screens

  • Functional screens

All cell types requiring stable Cas9 overexpressionLenti Cas9 Systems
AAVS1 Safe Harbor Site Cas9
Gene Knock-in System
Cas9 Protein
EGFP-labeled Cas9 Protein
PRE-CLINICAL APPLICATIONS
  • Off-target events are of highest concern
All cell types and applicationsCas9 Nickase, available in all delivery formats
Cas9 Protein
EGFP-labeled Cas9 Protein
SIMULTANEOUS ENGINEERING OF MULTIPLE MUTATIONSAll cell types and applicationsMultiplex gRNA cloning kit, compatible with all Cas9 delivery options
References
  1. Vasileva A and Jessberger R. Precise hit: adeno-associated virus in gene targeting. Nat Rev Microbiol. 2005 Nov; 3(11):837-47. PMID: 16261169.
  2. Petrs-Silva H and Linden R. Advances in gene therapy technologies to treat retinitis pigmentosa. Clin Ophthalmol. 2014; 8:127–136. PMCID: PMC3878960.
  3. Ran, F. A. et al. In vivo genome editing using Staphylococcus aureus Nature. 2015; 520:186–191. PMCID: PMC4393360.
 

How It Works

How It Works

Using saCas9

While saCas9 is just as efficient as spCas9, a few differences between the two systems will affect gRNA design1.

  • saCas9 PAM differs from spCas9 PAM
  • saCas9 works most efficiently with gRNAs of 21 nt – 23 nt

Contact us with any questions on gRNA design for saCas9 or about using our AAV-Cas9 vectors by emailing tech@systembio.com.
saCas9 PAM sequences:
NNGGGT
NNGAAT
NNGAGT

To create gRNAs for AAV Cas9 SmartNuclease Plasmids, use the following:

Fwd-5.1: ACCGNNNNNNNNNNNNNNNNNNNNN (N target sequence or gRNA sequence, 21 nts)
Rev-3.1: aaacXXXXXXXXXXXXXXXXXXXXX (X reverse complementary of N, 21 nts)

Example:

aavs1 gRNA for saCas9: CTGTCCCTAGTGGCCCCACTG

sa-AAVS1gRNA-5.1 ACCGCTGTCCCTAGTGGCCCCACTG
sa-AAVS1gRNA-3.1 aaacCAGTGGGGCCACTAGGGACAG

The workflow at-a-glance  

  1. Design two DNA oligonucleotides that are sense and antisense sequences of the target DNA and are immediately upstream of a PAM sequence (see above section on creating gRNAs for AAV Cas9 SmartNuclease Plasmids)
  2. Anneal the two oligonucleotides to generate a duplex
  3. Ligate the duplex into the pre-linearized All-in-one AAV Cas9 SmartNuclease Plasmid
  4. Transform into competent cells and grow in LB/Kanamycin plate (50 µg/ml)
  5. Confirm positive clones by direct sequencing
  6. Transfect sequence-verified All-in-one construct into AAV packaging cells
  7. Isolate packaged All-in-one AAV Cas9 SmartNuclease Plasmid using AAVanced AAV Concentration Reagent for easy, high-titer preparations

Your AAV Cas9/gRNA virus is ready for your genome editing project.

Genome engineering with CRISPR/Cas9

For general guidance on using CRISPR/Cas9 technology for genome engineering, take a look at our CRISPR/Cas9 tutorials as well as the following application notes:

CRISPR/Cas9 Gene Knock-Out Application Note (PDF) »
CRISPR/Cas9 Gene Editing Application Note (PDF) »
CRISPR/Cas9 Gene Tagging Application Note (PDF) »

CRISPR/Cas9 Basics

Through careful selection of the target sequence and design of a donor plasmid for homologous recombination, you can achieve efficient and highly targeted genomic modification with CRISPR/Cas9.

The system

A quick overview of the CRISPR/Cas9 System.

Cas9 protein—uses guide RNA (gRNA) to direct site-specific, double-strand DNA cleavage adjacent to a protospacer adapter motif (PAM) in the target DNA.

gRNA—RNA sequence that guides Cas9 to cleave a homologous region in the target genome. Efficient cleavage only where the gRNA homology is adjacent to a PAM.

PAM—protospacer adapter motif, NGG, is a target DNA sequence that spCas9 will cut upstream from if directed to by the gRNA.

The workflow at-a-glance

DESIGN: Select gRNA and HR donor plasmids. Choice of gRNA site and design of donor plasmid determines whether the homologous recombination event results in a knock-out, knock-in, edit, or tagging.

CONSTRUCT: Clone gRNA into all-in-one Cas9 vector. Clone 5’ and 3’ homology arms into HR donor plasmid. If creating a knock-in, clone desired gene into HR donor.

CO-TRANSFECT or CO-INJECT: Introduce Cas9, gRNA, and HR Donors into the target cells using co-transfection for plasmids, co-transduction for lentivirus, or co-injection for mRNAs.

SELECT/SCREEN: Select or screen for mutants and verify.

VALIDATE: Genotype or sequence putative mutants to verify single or biallelic conversion.

Supporting Data

Supporting Data

Genome engineering with SBI’s All-in-one AAV Cas9 SmartNuclease Plasmids

Both SBI’s all-in-one AAV-Cas9 and two-vector AAV-Cas9 systems efficiently correct a dysfunctional genomic copy of EGFP.

Starting with an Enhanced Green Fluorescent Inhibited Protein (EGIP) reporter cell line, which has an inactivated EGFP due to a premature stop codon, we designed a gRNA sequence and HR rescue donor to remove the stop codon and enable GFP expression. The gRNA sequence was inserted into either Cat # CASAAV300PA-1, EF1-RFP-U6-gRNA(SA)—the gRNA-expressing plasmid in the Two Vector AAV Cas9 SmartNuclease System (Figure 1, top panels)—or Cat # CASAAV100PA-1, the EF1α-hsaCas9-U6-gRNA(SA) All-in-one AAV Cas9 SmartNuclease Plasmid (Figure 1, bottom panels).

AAV virus particles isolated from both cell lysates (Figure 1, left panels) and packaging supernatants (Figure 1, right panels) were delivered to cells with the rescue HR donor and restored EGFP expression, indicating successful genome editing.

Delivery of AAV plasmid(s) alone (Figure 1, middle panels) with HR donor also restored EGFP expression, again indicating successful genome editing.

Both SBI’s all-in-one AAV-Cas9 and two-vector AAV-Cas9 systems efficiently correct a dysfunctional genomic copy of EGFP

Figure 1. Both SBI’s all-in-one AAV-Cas9 and two-vector AAV-Cas9 systems efficiently correct a dysfunctional genomic copy of EGFP. METHODS: Approximately 1 – 1.5 x 106 EGIP reporter cells were seeded into a 12-well plate for infection with isolated AAV particles (left and right panels) or transfection with plasmid (middle panels), along with the HR rescue donor. The top panels were treated with the Two Vector AAV Cas9 SmartNuclease System plus HR rescue donor designed to correct the defect in EGIP, restoring EGFP expression. The bottom panels were treated with the All-in-one AAV Cas9 SmartNuclease Plasmid plus the same HR rescue donor. Three days post-infection or transfection, EGFP-positive cells can clearly be seen, indicating successful genome editing.

FAQs

Citations